Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D063F11
Clone ID D063F11
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D063F11
Sequence
GATTCTCTGAGAGGAAATCTTTGTTTAAGGGCTGGGCGGCCGACCCTGGCCAGAGTTTCAAGTAGATGTGAAAACTTCCT
GCAGCCANNNGAGCCTCGTAGAACGGTCTGGGAGACTCGCCGGTCCGCACCACAGTGGCGGGAACCGCAGCCCGGCGATC
CTAGCATCTCCCAGGTCAGAAGAGCTGTAGTAAACAGGGTTGTTGACATGCGGTGAACTTCTCTCAGGAAGAAGAGGAAA
TGCCTGGACCTCACTCATAGGGTTTTGTACTGAGATTGAATATTGCAGAATTGCAGCAGTCCTGTTTCT
Sequence Type mRNA
Unitrap ID UNI10435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21844665..21845689 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067928 (Zfp760) NM_001008501 zinc finger protein 760 Gene [Source:MGI Symbol;Acc:MGI:2679257]


SPLK-Sequence tag 5SD063F11
Sequence
TTGTTGACATGCGGCGAACTTCTCTCTTGTCGAAGTGGAAATGTGCTGAGCCTCGCGCCTACGCTTTTGGGCTGAGATTG
AATATTGCAGAATTGCAGCAGTCCAGCATCCCTGAGTAACAAAATACTAATACACTNNNNCTTTCTCCTTGGGGTCCCCG
GGGACTTTGGCTGTACTCTGAGCTGGAGCTGTCTCTGAATGAGATGAGCCTCACATCTCACAGAAGAAAGTGAAAGCCTC
AGAGAAAAAGACAAAGTTTTCATGAAATTTCATCTGTTCTTCATGTTTGTTATTTTGGGATGTGTAAGGCTTCTTTCGTT
TTTGTTCCATGATGAAACTAGATACTCAGTAGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD063F11
Sequence
ACAGATTCATTTTTTTCCCTTGAGTTTTGATTGAGCTATGATTAGAAGTAGGATTCAAGTTATGGAAACTCAAAATGCTC
CCTGAATATTTTCAGCATGCTGACCCTATGTAACAGTTGGGGGATCATTTGTAGAACCCTCTGTTCCCTTTTCTGTATTT
CTGCTGAGCATAGTACTGTGTTAGAAATCCTGGTACTTACTGAAGAATCTCTCATATGCAGGGCTTGCACTTTTCAGCTA
CACCTATCTATCGTCGAGCAGGACAAAGTGCCCTGGAAGGTGGAGAGAGAGGCATCAGTAGCAAAGG
Sequence Type genomic DNA
Unitrap ID UNI10435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21845951..21846257 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067928 (Zfp760) NM_001008501 zinc finger protein 760 Gene [Source:MGI Symbol;Acc:MGI:2679257]

 
Come back to gene ENSMUSG00000067928


For any suggestions or comments, please send an email to unitrap@crg.es