Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D146A12
Clone ID D146A12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD146A12
Sequence
GGACAAGCGTTCGCTTCTAGGGCTAAGCCATGGGTATAGACCTTGGGACAATGGCTATTAGCAGAGTAAAATTCAGGGCC
TAGTGAGATAGCACTGACAGCCCTTCAGTGTGTACCACAGCGCATGTTGCTCATTAGACACCTAGTTTAAGCATTTCACA
TCAGCAGTGAGAAGGCTGGAGAAGCCTGATACTCTAGAAGGAGAATCCTGTTATCACAAACTCCACATTCCTCCTGGCAG
TCTGATGGAGATGCCTTGGTGCTAGAATT
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71021248..71021516 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]


SPLK-Sequence tag 3SD146A12
Sequence
GAAGACAGAGTCTGTGGCTCAGGAGAAGAGCACACTAAATTCAAGCTCCGGGCATTTCATGAGTGCACACACAAAGTCTC
TAGTTCAGAAGGTAAATGTGTCTATCGGTGATAGCTNNGGTGTCACAGTTGCCCACTGGGAAGTCAGTGGCCAGTTCGTT
TCAGGGAGCAAGGCATTCCATGGNNNGNGAACCGCATCCAGCATTAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es