Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D146A10
Clone ID D146A10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD146A10
Sequence
TCTGGTGCATCTCTTAATCCTGCACACTCTTGGTCCCTCTTCTTT
Sequence Type genomic DNA
Unitrap ID UNI22412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8914222..8914266 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023156 (Rpp14) NM_025938 ribonuclease P 14 subunit (human) Gene [Source:MGI Symbol;Acc:MGI:1914303]


SPLK-Sequence tag 3SD146A10
Sequence
ATTCACAGAGGACAGAAACTGAGGCCATGGAGGAATGGCTGAACAAGAGATCGGAGCCATGCCCTGAAGGCTTAGACCTT
GCTCTTACATTACAATGTTTAAACTTCAGAGCATTACCATGCTTGTGACGGGGCTTAACCCCGCAGTGGCAGCTGTGTAG
CTTAGAGAGAGGGCAGGAGATTGAAAGCTCAGGTAAGAGGCAGTTGCTAGTAAGATGTTTGTGAACATTCCTGCTGTCAG
TAGACGGCACCAACAGCGTTGAAACTCTTGAGTGTGATGCCTGATCTGAGGGCACCTCCATCTCTGTACAGCCTGCATGG
GGCAGAACTGTCTTACTCTGAGAACTCAAGCCTATGCAGAAGTCATTAAGTCATTTTCTTGAGGTTAC
Sequence Type genomic DNA
Unitrap ID UNI22412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8914410..8914788 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023156 (Rpp14) NM_025938 ribonuclease P 14 subunit (human) Gene [Source:MGI Symbol;Acc:MGI:1914303]

 
Come back to gene ENSMUSG00000023156


For any suggestions or comments, please send an email to unitrap@crg.es