Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D146A02
Clone ID D146A02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD146A02
Sequence
GATCTTAGCCTAGTTTCTTGAAGGGAGGGTTTACTTCCTGTCCCCAGGCCATTTTCTCTGGAGCTGGCCTTGATAGCAGC
TGCTTTTGGACAGAATTGCATTCCAGCAGTGGCTTACTCTTGGCTTCACATCTGGACTTGCTGCCTCCTGCACTGGTGGG
TACAAGTATAAGATATGGGGGTAGCTATGGGTGTCAGGTGGGGGCTAGACACTGCTCTCCCTTGTCATCCGCTCTCTTAA
GAGGGGAGTGACATGGGGTTACTGTAATTAAAGTGGGAGAGAGATGGTCCTTTATAAAATTACCCAGAGGAGGGCCTTGT
GTGGTAGATACTTTATCAATTGTTATAGGAAACCTCGTTCTACTCTTGTTTTACTGGGGTTGGGCACCGCCCCAGATAGG
AGATGTAG
Sequence Type genomic DNA
Unitrap ID UNI30033

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26116530..26116937 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037326 (Solh) NM_015830 small optic lobes homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1355075]


SPLK-Sequence tag 3SD146A02
Sequence
GTAGGAAGAATTGTACTTCCTACACCAAGAGCCCTGGAAGCACAAGGTGCAGTAGGTCTCCCTGGCCTTGACTTGGTGAT
ATCCCCAGATTGTCCTGGAAATGAGACATCCCACAAGTCTTTGGGAGCTCTGGGCAGGAAATACTGACTTGGCTGTGGTA
GTGTAGGACCAAAGGACAGCCTATACAAAGGGTTTGCAGCCCTTAGACAGGTTTTGGGGCTTGTGAGAGCCAATCCAACC
TCCAGGCCTAAGCACCTGTGAGGAAGAGCCATGAGTCTGTCCTACCTGAAGTATACTAAGCATCTCCCCTGCAAATGGGT
CCTCAGAGCTGAAAGTGAAGCTGTTGATGCCATAGCTAGGACTTGGCCTCCTGACTGAGAGGACACCCTTATGTGGCTCC
ATGCAGAATCTAATGGAAGTGTCATCCTGTCTTCTCATGCTTGCCCTGGGTGGATACCCCCCAGCTGTCCTCAACAAACA
CACCAAGGCTGGGGACATGCTAATGCAGCTTGATAATTAATACTTTGTCTTTTAGAGCAGTGGCAGTCCCATTCCTTGAG
GCCAG
Sequence Type genomic DNA
Unitrap ID UNI30033

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26115968..26116533 552
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037326 (Solh) NM_015830 small optic lobes homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1355075]

 
Come back to gene ENSMUSG00000037326


For any suggestions or comments, please send an email to unitrap@crg.es