Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D063E07
Clone ID D063E07
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D063E07
Sequence
CACTCCCTCCCTNNTCTCCTTATCNNACTCCCACACCCTCNNCCCCCCGTCNNTGCCGCCACGGTTTTCCCCGCAGTAGC
TCATCCACCCTGAAAGGGCCGCCTCAGNNNGGCTCCTTCACANNCCCCCCCTATCCTTTGAATTGTGCTCGGGGAAGGTC
CGGAGCTGCCCCATGGATGAATTGCCCTATGATGATGTGCATGTGAACTTTACTCTTGAAGAATGGGCTTTGCTNNNNCC
TTCACAGAAGAGCCTCTACAAAGATGTGATGTTGGAGACCTACAGGNNNCTCAATGCTATAGGCTACAATTGGGAAGACA
ATAATATTGAAGAACATTGTCAAAGTTCCAGAAGACATGGAAG
Sequence Type mRNA
Unitrap ID UNI10437

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98288920..98289296 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074887 (A630089N07Rik) RIKEN cDNA A630089N07 gene Gene [Source:MGI Symbol;Acc:MGI:2444323]

 
Come back to gene ENSMUSG00000074887


For any suggestions or comments, please send an email to unitrap@crg.es