Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D145B04
Clone ID D145B04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD145B04
Sequence
GATCCGGAGGGACAGGGGACTCTGGGTGCTACCGGAGTACATTCCCCTTGTTGACCAGCGCTTGACTGTCTGGACGCGTG
GGCGCCTGTGGTTCAGCCAGTCTTCCCGGAGCTGGCATATCCGTATGTCAAAGCTCATGGAAACTTGAGCGCAGCGCCCC
TCCAGGGAACGGTTGTTACTGATGCCGCGAGCCTGACTGCTGGAGGGGGTGACCCCGAGGCAGGACGCAGATTGCTGACC
CCCATCTTGGCCAGTGCGCGCCCCTGAGTCTGCTCTGTACCATGGGGTCAGGCCGGGTCCCAGTGGTCCTTTTCGGGGTG
AATCGGGTCCCCCAGGTGCCTGGCGTAGCAGCCCTTCGCCCCTAAGATGAGCAGGACTTCAGCCTACTGGAGATGGCGTG
GGTGGACTTGTGCTGCTGCGCAAGGCAAATCCATCT
Sequence Type genomic DNA
Unitrap ID UNI5356

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124890138..124890573 436
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049327 (Setd8) NM_030241 SET domain containing (lysine methyltransferase) 8 Gene [Source:MGI (curated);Acc:Setd8-001]


SPLK-Sequence tag 3SD145B04
Sequence
CTTTGAAGGTATAATATGTTGTCAGGATAAAAACCCCCGTTATGCGGCAAAGGG
Sequence Type genomic DNA
Unitrap ID UNI5356

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124890572..124890625 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049327 (Setd8) NM_030241 SET domain containing (lysine methyltransferase) 8 Gene [Source:MGI (curated);Acc:Setd8-001]

 
Come back to gene ENSMUSG00000049327


For any suggestions or comments, please send an email to unitrap@crg.es