Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D145A06
Clone ID D145A06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD145A06
Sequence
GATCCTGGAGCATGCTCTGTTTCTTCTCTGTGTGTAAATAAGAGGAAAGCATAGAAAAGAAAATGA
Sequence Type genomic DNA
Unitrap ID UNI2350

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 63395914..63395979 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021458 (2010111I01Rik) NM_028079 RIKEN cDNA 2010111I01 gene Gene [Source:MGI Symbol;Acc:MGI:1919311]


SPLK-Sequence tag 3SD145A06
Sequence
CTTTCTTCCGTGCACTGGCATTATGGACGACCTGTCTACGTCCATGAACAGTGTACAGCGCACCCTTCCATGGGGTGAAA
GCCGTCCTTCCTCTGACCAACTCTCTTCCTGATCTGCCCCCAGAGGCCGACAATGTTGCTCTCCTTGTGTAACATTCATA
AATGAGTATATCTCTTACCCTGCCAGTAATTAATCTCAATGTTTCACCCCAACCCGTATTCCTGTAGCTATCTAAAGCCA
TTTACTCTCTTAATAAAATATCACATGTAAATTGCACTTTTAGAATGACACAAGTCATAGCATCGAAACAGTATTCAGCA
AAGTCCGACCCAGCTCTTGTATGTGTGCAATTATTAAAGGTGGGCATATGTATTTGTGTAGTTCAGCCAGGTCCTACATG
AAACGTCACCATAGTTTCCACTTAAGTATGCTAATATTCCAAGAGGGTTTAGGCAACTCCTGGATTNNCAGAGATNCAAC
CCAGTTCTTTCTCTGGCCTGACTGAACGGGTAGCCCACCAGTAAACCCTGGTGGACTGTCATACCACGCTCTCCTGGATA
GCCNNGGAGCTCACCAACAAAAGGTTCTGTTGCCAGCTTTTGCGTGTGGCTAGGCCATTGAAAGANCTNNNATTAGGAAG
AAAGGGAAAGGGACAGACTACCCCCCTACCCCTGCCCCNNNGNCCCGATGCCCNNTATCCTGGTGCCTGCCACTGGNTCT
ATCTGNCNNANNCAGGNNANNNATTCCTTATGGTTTCCCAGGGGNNCTGAAAATTCAAGAAACCTTGTANNGNAATGGGG
TNTGNGGGGGNNNAACCAAAATGTAACATTTTATTCCCGATGCAAAAGGAACAAAGCCATAAAAACNGGGTAAATTGAGG
GGACTTTAAATTTTTGGGTNNNA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000021458


For any suggestions or comments, please send an email to unitrap@crg.es