Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D144F10
Clone ID D144F10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD144F10
Sequence
GATCTCAGTTGAGACCATACTGGCCAGCCAGAAAACTGATTTCAGTTACATTTGGCCAACTCCTAT
Sequence Type genomic DNA
Unitrap ID UNI134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122617862..122617927 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004455 (Ppp1cc) NM_013636 protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI (curated);Acc:Ppp1cc-001]


SPLK-Sequence tag 3SD144F10
Sequence
CTATCTAACAGGTGTTTATTATGAGAAAAAAAATATTCAATATCACACCACGCCACCCTTCTCAAGTTAACATTTTTTCT
AAGGTTCATTTTTGTTATTGACGTGTCTGTGCATTTGAGTGCAGGCGGCAGCCTTGGCCAGAAGCTACAAGCAGTAATTA
GTTAGCTGCT
Sequence Type genomic DNA
Unitrap ID UNI134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122617924..122618093 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004455 (Ppp1cc) NM_013636 protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI (curated);Acc:Ppp1cc-001]

 
Come back to gene ENSMUSG00000004455


For any suggestions or comments, please send an email to unitrap@crg.es