Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D144F01
Clone ID D144F01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD144F01
Sequence
AAATGGGCAGTGCCTGGAGAGGCCCTGAGTTTGTCTGCGGGCGTGCACTTACTCACATGTGCACTAGTGTCTTGTGGCTG
GTGTGTGGAGCCAGTCTTTCATTTCACTTGTTTGCCAGCCCATTGTCGTAGCTTAAGCAATGAGTCTTTCTGCTTAGGGG
TTGTCAGCCTCTGAAAAGTTGTATTGGAGGAAGATAGTGGCATCTGTAATGCACTGTTCACATCTGCTTCATGAGTTGTT
TTTGAAAGCAAGTGATACGCCATAT
Sequence Type genomic DNA
Unitrap ID UNI5169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92504416..92504680 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029405 (G3bp2) NM_001080795 GTPase activating protein (SH3 domain) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442040]


SPLK-Sequence tag 3SD144F01
Sequence
GCCCCNNNTTCATTCCCTTGCTACTCACATAGAATGATTCGCTGATGCCTNNGATCGATGGTCCACGGCTTGAATGTGAC
ACCGCTCTTCTGGTAGCTTTAGACACTAACATGCATGTGAATAAAAATAAAGTCACACATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029405


For any suggestions or comments, please send an email to unitrap@crg.es