Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D063D08
Clone ID D063D08
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D063D08
Sequence
CGGGTCCGCGCGCGTCCCGGAGCCCGGAGCCTGCAAGGTATGCGCGGACACTACGAGGCTCCGGGAGCAGCAGGGAGCTG
GAGCAGTCCCCGATGCAGCCGATGGCTTCGGCATCCAGCCCG
Sequence Type mRNA
Unitrap ID UNI10439

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141794900..141795021 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040606 (9030409G11Rik) NP_001103155 RIKEN cDNA 9030409G11 gene Gene [Source:MGI Symbol;Acc:MGI:1918779]


SPLK-Sequence tag 5SD063D08
Sequence
ATGGCGTCCGTGTCTTCAAGGACAGAGAGTTTCAGTGATGTCTGGATCACACGGCAGCCAACACGGAAGTGGTTTTTGTT
TATGGGAGTTTTCTTCTAGGAAGGAAATGGGAACTCTTTGCCTTAGAACCACAAGCAGAAGCTGTTGGGGGGAATAAA
Sequence Type genomic DNA
Unitrap ID UNI10439

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141791452..141791609 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040606 (9030409G11Rik) NP_001103155 RIKEN cDNA 9030409G11 gene Gene [Source:MGI Symbol;Acc:MGI:1918779]


SPLK-Sequence tag 3SD063D08
Sequence
CTNTCCAGCCAGCCGCTGTCCTTAGACTCTCAGCTGTTTGTACCAAACTGGACACAATGCTCAGTTTAAAG
Sequence Type genomic DNA
Unitrap ID UNI10439

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141791368..141791438 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040606 (9030409G11Rik) NP_001103155 RIKEN cDNA 9030409G11 gene Gene [Source:MGI Symbol;Acc:MGI:1918779]

 
Come back to gene ENSMUSG00000040606


For any suggestions or comments, please send an email to unitrap@crg.es