Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D144B06
Clone ID D144B06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD144B06
Sequence
CTCTCACTGGCCCATATACCCACTGGACTATGGAGGCTGGCTTCCGCCAGATGTCTCTCTTCGGAGCTTGCCTTTGCCTT
TCAGTGCCTCAGCCTGACTGGTTTTTCTTCTACTCTGTTTTATTTCTGTGGGACTGGGATAGTACACAATGCTTCTCTGT
CTCAGGTGACCATGGATGCAGAAAAAGGTAAGGGCTAAGGTGCTCATCGCTCATCCCAGAGAATCCTGATTCTTCTTCTT
CCTGTCCTTACTGCTGCGTGTGCTCTACCTGTGTCCAAAACAAAGTTTC
Sequence Type genomic DNA
Unitrap ID UNI9642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140842789..140843077 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029560 (Snx8) NM_172277 sorting nexin 8 Gene [Source:MGI Symbol;Acc:MGI:2443816]

 
Come back to gene ENSMUSG00000029560


For any suggestions or comments, please send an email to unitrap@crg.es