Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D143E12
Clone ID D143E12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD143E12
Sequence
GATCTTTGCCAGTTTGAGGCAACCTCGTTTACATAGTGTTTACATAGGCAACCTCCCCTATCTCGGGGAGGGGGCCGGCG
AATCCACCATCAGAATTGTAGTTTCTGAG
Sequence Type genomic DNA
Unitrap ID UNI1163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124475712..124475820 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025316 (Banp) NM_016812 BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]

 
Come back to gene ENSMUSG00000025316


For any suggestions or comments, please send an email to unitrap@crg.es