Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D143D05
Clone ID D143D05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD143D05
Sequence
GATCCCAAACTTTTCCCTCTTCAGCGTACCTGCCTCCTTCCTATCGCCCTTTCTAGAAACAAGCCTGTCTGCAATGCCTA
TTAATTCCCCATCGACCGTTTCACTTTCTGCAGCTCTCACTGTAAATAATTATTTTAGTACAATCACTCACAGACAGTTT
CTCTGAAGAAAAATGTATTCAAGC
Sequence Type genomic DNA
Unitrap ID UNI11583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53138457..53138640 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018239 (Zcchc10) NM_026479 zinc finger, CCHC domain containing 10 Gene [Source:MGI (curated);Acc:Zcchc10-001]


SPLK-Sequence tag 3SD143D05
Sequence
CAAAGTTAAGCTTTAAAGGGGATAATAGGCTGTGGTGAGGAAAGGCAATAGGCCCAGTTCAAGTCAGTTCTAGAAATTCA
TCTGTGAGGGGTGACATTTGAAAACGTACTAGAACCCATATAAAGGACTGATTCAGCAGAGGATTTGGGGAAAGATAGGA
AATGGTATATTTGCTATGAGTCTGTTATAATTTGGGGGAGGGTTGGGCTGATTTAGATACACGATTTGTCTGTGTAGCCC
TGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018239


For any suggestions or comments, please send an email to unitrap@crg.es