Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D142G07
Clone ID D142G07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD142G07
Sequence
TACTTTTTATTTAAAATTTTAATCGCTTATGATANNNNAGTAATTTGGAAAAATAAACATTAGGTCATTTGGCACGATAT
GCCTTTCATCANNNATCTGTCAGTTTAAAAAAATGCTGCAAGAAGTTCCATTTTATGTAGACTCAGAACATGCCCTCTCG
GGATGCTGGTTCACATAATAAAATAGTTTCCTTTTGTAACTTAGAATCAAAATAGTTACTTGGTTCTGAGTTGATTTTAT
ATCTATCAAGCAAGATTTTTGCATAAAACCCAGATGACTAACTATAAAATAGAAGATGAATCCATATTGTCTTTTCAATG
ATAAATATAGTACATCTTTAGGGAAATTGCTGTTATTCTGTCCATGGATGCTTTTATTCCCTTAACTGAGATAAAATGTA
TGTTCGTGTCACTCCAGTAGCTAGTTGTTTGTGAAAGACTAAATAAAATTGGTCTCAAAGCATGTGGCAGCTAGCTGCAC
AAACCCAGACCTGGGTGTGGTCAGCCCCACAGGGATAGTTAATCCGAAGCAGCTTCCCACCAGGTTTTTTGTTTGTTTGC
TTGTGTTTGTGGAAAAACACGCACTGTTGTTACGATGTAATCTGTAACATTGTAT
Sequence Type genomic DNA
Unitrap ID UNI27652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8513142..8513756 594
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027500 (Stmn2) NM_025285 stathmin-like 2 Gene [Source:MGI Symbol;Acc:MGI:98241]

 
Come back to gene ENSMUSG00000027500


For any suggestions or comments, please send an email to unitrap@crg.es