Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D142F11
Clone ID D142F11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD142F11
Sequence
GTGGCTCCTTTAGAAAAGTGGTTTACCAGCCCTTCTGAAGGGCTGCCTGGCCTGTTTGTTTATTTGCTCAGCCCAGCCCC
TCCCTATGCAGTAGAGGAGGCAGGAAAGACCTGCAGGTGCAACCTGCTAAATACCTGTAGCAGCCTGAGCCCCTCTCAGG
ACTCAGGGGGACCTACCAACTCTGCCTCAGAAGCCAACCACTCAATGGCTTGCTCTTGGGCCCGTTGTTT
Sequence Type genomic DNA
Unitrap ID UNI30040

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141725460..141725689 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040606 (9030409G11Rik) NP_001103155 RIKEN cDNA 9030409G11 gene Gene [Source:MGI Symbol;Acc:MGI:1918779]


SPLK-Sequence tag 3SD142F11
Sequence
GTTTTTCCCTGTGGCCCTTTGGGTAGTGAGTCTCCACATGGG
Sequence Type genomic DNA
Unitrap ID UNI30040

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141725422..141725463 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040606 (9030409G11Rik) NP_001103155 RIKEN cDNA 9030409G11 gene Gene [Source:MGI Symbol;Acc:MGI:1918779]

 
Come back to gene ENSMUSG00000040606


For any suggestions or comments, please send an email to unitrap@crg.es