Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D141G12
Clone ID D141G12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD141G12
Sequence
GATCTGTGTACTCTGGGGCTGGTATTCTAAGGGAGAATGTACTGCCCACCAGGGACACAGTGTGGTCTTTGACTTCCTTT
GAAGTCAGTAATGGAACGCAGTATTCTGGTATAGAAAGGTCCAAAGTAGATGGTGGTAGTGCACCCCTTTAATGC
Sequence Type genomic DNA
Unitrap ID UNI1464

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72504625..72504778 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]

 
Come back to gene ENSMUSG00000036180


For any suggestions or comments, please send an email to unitrap@crg.es