Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D139G01
Clone ID D139G01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD139G01
Sequence
GATCTCTGCACCAGCCAGCACTGCCTCCTTCCCCCACGGGCCACCGGCCATTCCCGGCTCCAGCGGGCTCCACCATCTGA
GCCCCCCTGGGAGCGGACCATCCCCTGGGCGCCATGGCCCCCTCCCACCCCCGACCTACGGCACCCCACTCAACTGCAAC
AACAACAACGGCATGGGCACCGCCCCTAAGCCCTTCCTGGGGGGCTCTGGGCCTCCCATCAAAGCAGAGCCAAAGGCCCC
CTATGCCCCAGGGTGAGTGGGGGCAGGGAGTGGGTGGGGACAGGATTTAGGGGCACAGTGTTCAATGTCCAGCAGATGTT
GGCCCCTGGACT
Sequence Type genomic DNA
Unitrap ID UNI30044

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10303063..10303394 332
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036098 (Gm98) gene model 98, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2684944]

 
Come back to gene ENSMUSG00000036098


For any suggestions or comments, please send an email to unitrap@crg.es