Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D139E05
Clone ID D139E05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD139E05
Sequence
ATAGTTTCATCAAGAACCTGTTACCACCAGTTCTCAGCTTGCCCGTCCCTTCTAACACTCAGCAACCTTAAGCTTCCTGC
TTCTGTTTGGTG
Sequence Type genomic DNA
Unitrap ID UNI30045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71298758..71298849 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041921 (Metapl1) NM_025633 methionine aminopeptidase-like 1 Gene [Source:MGI (curated);Acc:Metapl1-001]


SPLK-Sequence tag 3SD139E05
Sequence
CTTCTATGCGTAGAGTGCATTTATTATTAGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000041921


For any suggestions or comments, please send an email to unitrap@crg.es