Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D139E03
Clone ID D139E03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD139E03
Sequence
GATCCCCGGGATGGGCGGCCGAACCTGAGACCATCCGTGTGGGCGCGGTTTTCTCCAAGGCCAGCTTGGTGACCCGTGAG
CTTTTCCAGCCCTTTTTACTGAGAAGGAAAAGAAGGATTTTATTGAACACTCTAGAGGGCGGAGTAATTGCTAGTGAGCG
TGATTAAGAACCGGGTGGCCTTGCCGTGGCTTTGTTTGTCGTATCTGGCAATCAGCTTCAGTGGCACTCTCGTTGGGCTT
GTCAAGCTTGGCAGTGGCTCTTTTAACCCTTTCCTGCCGGGTCCATTCATCCATGCTAGAAATTTGCCTTTACCTGAGAA
CAAGGCTTTACCACAACTTTGGGTGCAAGTCCTGGACATGATGTTGTTGCTTTTCAGATGCAAATTTAAAAACTTTCAGA
Sequence Type genomic DNA
Unitrap ID UNI672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 143741522..143741918 386
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015932 (Dstn) NM_019771 destrin Gene [Source:MGI (curated);Acc:Dstn-001]


SPLK-Sequence tag 3SD139E03
Sequence
CAGAAAGCCCGTATAATTACTCCAGNNNCTTTAAAAAGAGAAACATTCGTTGTATTGAGATGGTAGAGATTTTGCTTAAT
TTACAAACTTCTCTACCTCCAAAGTGTTACTCAAATCGGTTGTAAAACAGTATCTCAACTGGGCGATCAGGTGGAACATT
TTGTCACTGTAGTCTGCACAATGTTACCATTTTTGGTCAATGATTTGCTGGCAAGGCCTTGCCTCACTGCTAGAAATACT
ATCCTGTTGCTACATCTGTGCGCCGGGAAACAGTTGGTACCCACTTATCTGTCTACAGAGTGTTTTCACTGAATAACAAC
TTTGGTTTTTTCTTAGGATATAGCAACTGGCTTGCAGGTGCAGGCTGGCTCATTAGATTAAATGGATAGTTTTCTTGAAA
ACGGACCATGCTTAGTTGTGCCTTGATATTAAGTCATGTTTGGGTTTAATGCTATGAGCTGCAAATATTTCAGGCCCTGA
AGTCTGTTGAACCTCAGCAAGATTTTAAGTGTATGTATATGTTGATTTATAGTAAAGACTAAATATAAAGGTTTTGAGTG
CTGATAAACTTTTAAATTTGAGCACTCAGTGTAATAAAGTGAACTGGTGTCTGCTCTCCAGTCTTCTTTTAGTTGAGAAT
GCAAAAGTATTTAAACAGGGCCAAACATT
Sequence Type genomic DNA
Unitrap ID UNI672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 143741915..143742583 646
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015932 (Dstn) NM_019771 destrin Gene [Source:MGI (curated);Acc:Dstn-001]

 
Come back to gene ENSMUSG00000015932


For any suggestions or comments, please send an email to unitrap@crg.es