Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D139A07
Clone ID D139A07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD139A07
Sequence
GATCTGTCTGCTGCTCTGGTGCTGGGCATTGGTGGGAGGCTGTGTGCTGCAGGGCAGGGGTGTGAGCACCGTGCACTGCG
GAGCATTTCTGCTGGGAAATAGTTAAGGTTCTTACAGATTGAAAAATGACAACAGTAAACTATTTAACTAGAGTCTATAA
TGTATATCGTTCACAATGATATGTAAAAAGACAGTGTTCTGTAGCATTCTAA
Sequence Type genomic DNA
Unitrap ID UNI7051

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108746694..108746905 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028559 (Osbpl9) NM_133885 oxysterol binding protein-like 9 Gene [Source:MGI (curated);Acc:Osbpl9-001]


SPLK-Sequence tag 3SD139A07
Sequence
ATATGAAATTTTAGGTAGATACTGATAATTTTTAGAGAAGGCTCTTTTTAGACCTTCTTAAACCTGCTAATAAAGTCATC
TTCTTACCATAACCTGCTGAGACAGTTTTATGCCAGTAAATTGCCATAAATATATTTGTAAAAAATATGCTTTAAAATGT
TATTTCAAATTTATGTTGAGAAAAAGTATTAATCCTCTGTGGACTTTGCTCAAGG
Sequence Type genomic DNA
Unitrap ID UNI7051

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108746254..108746468 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028559 (Osbpl9) NM_133885 oxysterol binding protein-like 9 Gene [Source:MGI (curated);Acc:Osbpl9-001]

 
Come back to gene ENSMUSG00000028559


For any suggestions or comments, please send an email to unitrap@crg.es