Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D138G07
Clone ID D138G07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD138G07
Sequence
GATCCGGATCAGGTGAGACCAGGGAGGCCTGGTGAGGGAAGAAGCTAGCGGTGCTTCCGCCGTCTGCCGCCCGTGTGTCT
GAGTCCACCTTGGCTCCTGGTGTGTTGGTTATGAGAGTCGTGAATATGGCACAGGGTTTGGAGTACGAGAACCTGGGATG
AGAACGTGGTTCCTTCCGTTCATTGCTTAATACTGAGAAGTGCTCTTAAACTTAAGTGTAGGTCCTATAGTACAGGGACA
CAAATGGGTGTAGACAAATGACCTACCCAGGGTCATACAAT
Sequence Type genomic DNA
Unitrap ID UNI16055

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3283160..3283440 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024829 (Mrpl21) NM_172252 mitochondrial ribosomal protein L21 Gene [Source:MGI (curated);Acc:Mrpl21-002]

 
Come back to gene ENSMUSG00000024829


For any suggestions or comments, please send an email to unitrap@crg.es