Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D138E02
Clone ID D138E02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD138E02
Sequence
GACCTGAGAGGATGCATTTCATGCCACCCCTAGTTTCAGAGACATGCAAATGATAGCTGTGATATTACTGATGTAGATGC
TGAGTTCTACTTATGGTATTTAGGTCTCAGACAAAATTTTCTGTCTCTAGGCTCCAGAGAATGGTGGTCAGTGGGGTCGG
GTTTCACACTGAGACTCGTTTTGCCTCTGCTGTCTGATCAGAAGATAAAATATACAGACAATGACTTTTCTGCCCATCAG
TTAAGTTTTTAGGGTAACAGAATAACTTGG
Sequence Type genomic DNA
Unitrap ID UNI1321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152066185..152066454 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074698 (Csnk2a1) NM_007788 casein kinase 2, alpha 1 polypeptide Gene [Source:MGI (curated);Acc:Csnk2a1-001]


SPLK-Sequence tag 3SD138E02
Sequence
GCACATTTGTATGCTAGGATTGTAATCTAAAGATAAATAAAATACCCTGTGGGTTCCTTTGTCAGTGAGTTGTATTATTG
TGACCCTTATGGAATTAGGTCTTTCTTTGTAGTCCTGACTGTCTTGGAATTGTGCCATCATTCCCATCTTTAAAGTAGTA
TTTTTAGGGAGTTATCTGGGTGTCATCCCAGGTGCACATATAATTGTTCTATCACTAAGCTACATCTGTAGCTATTATAA
ATATTATATCCTAAAATCAGACCCTTAATAGGACCTGAGAAAATTTATTGTTTTCAATTGGAAGTTTTCTTAAGTTTAGT
GTTCAGTTGAAACTTCGAAATTTTAAAGTCAGAGAAAGCCAGGGAACTCTCAAAATTCTAGTTGTTGGTTTTATTAATAT
T
Sequence Type genomic DNA
Unitrap ID UNI1321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152066687..152067087 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074698 (Csnk2a1) NM_007788 casein kinase 2, alpha 1 polypeptide Gene [Source:MGI (curated);Acc:Csnk2a1-001]

 
Come back to gene ENSMUSG00000074698


For any suggestions or comments, please send an email to unitrap@crg.es