Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D138C09
Clone ID D138C09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD138C09
Sequence
GATCTACAAGATAAAAATAGAAGACTGGTTGAATCTCACTATATAGTTATAGTCTTCTTTGTTGTATGGAAAAATTAGGG
GTATCTATGAAAATAATCTTTCCTTATTCACTGGTACTCCTCACACTATGACCAGCTAACTACAGATAGTTATCACTGTT
CTGGGAACCCTGGAAAGTCATAGTATAAAGAGGTCCTGTGTTGTGGAATCTCCTTAGTAACTAATAA
Sequence Type genomic DNA
Unitrap ID UNI30049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 54231559..54231785 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053852 (Gpr112) NP_001104260 G protein-coupled receptor 112 Gene [Source:MGI (curated);Acc:Gpr112-003]

 
Come back to gene ENSMUSG00000053852


For any suggestions or comments, please send an email to unitrap@crg.es