Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D137H03
Clone ID D137H03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD137H03
Sequence
TGGGTCTTACGGGGCGGAGCTAGGGCGTAATGAGCCCCGCGCTATGGGCGCGCCTGGGGCGGGCCTTGAAAAGCTACTGC
CGGCAGCCTGCACGCCAGACGCCGCCATGATCATCCCGGTGCGCTGCTTCACCTGCGGGAAGATCGTCGGCAACAAATGG
GAAGCCTACCTGGGTCTGCTGCAGGCCGAGTACACGGAGGGGTGAGACGGCGGGCCGCGGGGGATGGGACAGGACGGGAA
GGCTGGACTGGGGGCATGAAGTCGAGGGGCAATGGGGAGGGTTCTGCGGCGGACCGGGAGTGAAATTGAGGTGTCCTGGG
CCGGGGGTAGATAAGATTTCCTATGGAGAATTGGCAGGGCAGGGGTTGTGGGGTCTAGTGAGAAGACTGGATGTCCTCCA
GCCCAGACCTGTGATGTATTCCCAGAAGAGTGAGTCTTTAG
Sequence Type genomic DNA
Unitrap ID UNI10358

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148660687..148661127 439
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038489 (Polr2l) polymerase (RNA) II (DNA directed) polypeptide L Gene [Source:MGI (curated);Acc:Polr2l-001]


SPLK-Sequence tag 3SD137H03
Sequence
TTTTCTTCAAGTTGCTGGCCATTNNGGAAACTTCTAAGCATCCTTCCCGNNGGTGACACCTCAAGTCTCTTCCCTGTCGA
CCTACTCTCTATCCTCTATCTGCTTTCCGACCTACCCCTTATGTACTTCGAACCTCGTGGGCCCTTTAAAATGCAGGACA
GGCTTTGTGGGCATCGTCTTGTGCTCACTACTATGACTGTCCCCCAAAATAGACCTCTGGCCACCATGTCAACACCAAGG
GGTTCTCTTTCTCTGCACAAGCCATAAGTCAGTGGGGCTTAATGAGCAGCTATTAGATCAGCTCTGATGAGTAGCTGCTA
GCCTTCTGGGACCCTCTTTCACTTGGGCAGGAACCTCTCAAGCTGTCTAGGTCCCAGAGAAATTAAATCTAGTGTGAGTT
CAAAGCCTGTGGGGTAGCAACAACCAGTTCATGGCGTTTAGTCAGAGTCCACCTGTGGGGCCTGGAATTGTACTCCTTGA
TGAGGGGATATTGGTCTCCTAAGCTTTCCCAAATAACCCTGGAAGCCCATAACCCTGGGTACAAGAGACAAACGCAGAGA
TACAGGGGGTTAGAGAGATGGCCCAACTGTTTTTTTTGTTGTT
Sequence Type genomic DNA
Unitrap ID UNI10358

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148659934..148660535 591
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038489 (Polr2l) polymerase (RNA) II (DNA directed) polypeptide L Gene [Source:MGI (curated);Acc:Polr2l-001]

 
Come back to gene ENSMUSG00000038489


For any suggestions or comments, please send an email to unitrap@crg.es