Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D137D03
Clone ID D137D03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD137D03
Sequence
TTATACCAAAAACCACGTGCAACTGTTATTTCTTCAACTAGCGCTATTTTCTACTTTCCTCTACGGGGGGCGGGGGAGGA
GAGCGGAAGGGGGCCCACTGTTATTCCTAAAATAAAATTTCATACTACTGAACTTCCNNNTTCAGATTTNTTCTGCTATT
GATGATTGAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD137D03
Sequence
ACACAAATTGATCAATCAAATCTCTTTAGGTGGAGGTGGTTGTATCTCTTCATTCTTACTGAGAAGATGTATCAGACAGA
C
Sequence Type genomic DNA
Unitrap ID UNI30053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 61742695..61742775 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047804 (Akap10) NM_019921 A kinase (PRKA) anchor protein 10 Gene [Source:MGI (curated);Acc:Akap10-001]

 
Come back to gene ENSMUSG00000047804


For any suggestions or comments, please send an email to unitrap@crg.es