Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D137A04
Clone ID D137A04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD137A04
Sequence
TGTGTGTTGCTCAGTTCTTTATATACCAGTCTATAAATGATCTCTTCCTTCCTACAGCTGTGTTGAGAACTAAAAATCAT
TAGCTTGCTCAACTTGAACCAACTAATTACTCTTTATATGGAAGGCATTATCTGCCTGCATGCCTGTCTTCTTTCTCTTC
TAACACCAAGCTATATTTTCAACCCTTAAATAATTTTAGTTGTTAAAA
Sequence Type genomic DNA
Unitrap ID UNI11537

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29141725..29141932 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]


SPLK-Sequence tag 3SD137A04
Sequence
AATGTTACTGTCAAGCCGGGTGTGGAGCCACACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAG
TTCGAGGCCAGCCTGGTCTACAAAGTGAGTGCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCCAAAAAAAAAAA
AAAAAAATACAACCCCCCTCTTTTTCGTTTGGGGGGAAATTGGGGGGGAAACCTTGTTTCCCCCCC
Sequence Type genomic DNA
Unitrap ID UNI11537

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29141552..29141726 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]

 
Come back to gene ENSMUSG00000024006


For any suggestions or comments, please send an email to unitrap@crg.es