Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D137A03
Clone ID D137A03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD137A03
Sequence
GATCCACTTGCCTCTCCCTTCTGAGTGCTGTGA
Sequence Type genomic DNA
Unitrap ID UNI17235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72842557..72842589 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034563 (Ccpg1) NM_028181 cell cycle progression 1 Gene [Source:MGI Symbol;Acc:MGI:1196419]


SPLK-Sequence tag 3SD137A03
Sequence
GATTAAAGGCGTGCGTGACTCTCCTAAGAGACGCTGTCTTAAAACCACGAGGACTGCTTGCCACTCTTGTCCTTTGGCAT
CTTTATGTGTGTGCATGCATGCAGGGACACGTACAGGCATGTGCACCCACGAACGTACATATAAGCACAAAGAATACCTT
CATTAACACAGCTACTTAATTAGAATTAGAAGTAACA
Sequence Type genomic DNA
Unitrap ID UNI17235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72842588..72842784 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034563 (Ccpg1) NM_028181 cell cycle progression 1 Gene [Source:MGI Symbol;Acc:MGI:1196419]

 
Come back to gene ENSMUSG00000034563


For any suggestions or comments, please send an email to unitrap@crg.es