Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D136H02
Clone ID D136H02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD136H02
Sequence
GTCCAGGGCGCATTGCAGAAGGTCTGACCTGTGTTTCCAGGGTGAAGAATGCTGAGACCTAACTGGGTGCGGCCTCTCCG
CCCCGAGAATGGCCAAACCTATACTTTTGCTTGTTGTGGAAGAATGTCCCAGGCTCTCTGAGTTGGTAGGGAGAATGGTG
AAACTGATTGACCATCCTCTCTGATGGCTGACTACCAGCCTTCCCCTTACAAGAGTTGCTAGTTGTCTCTGTGAAGATTT
CTGGTGTGTCCACTCTCTGAGCTGCTTTCAACTCTACCTTGCCCACCCTTAGCCTTGCCTTCACTGACACAGGAACCTTC
GCATCGTATTAGAATGATGGCCATCAGAGCTTCTTCTGAGATCATGGGGCCAGCCTTTCTCAGATTAA
Sequence Type genomic DNA
Unitrap ID UNI29544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100250858..100251244 372
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]


SPLK-Sequence tag 3SD136H02
Sequence
AAAACACACCCAAAGGGGCTGGAGAGACACCTCAGCTGTTAAGAGCACCAGCAGCTCTTCCAAAGGTCCCGAGTTCAGTT
CCCAGCACTCACATGGCAGCTCACAACCATCTGTAACTCCATTTTCAGAGG
Sequence Type genomic DNA
Unitrap ID UNI29544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100250562..100250692 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es