Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D136F11
Clone ID D136F11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD136F11
Sequence
GATCCAAGTCACAGGTTAGTTGCCTGTGTCTCTTGATGTATTCCTCCCAGAGGAACTCCCAACATCAGTGTTCAGTCCAA
CAGCGCACAAGTTGCTCAGGTGAAGGAGAGGGTATCTATTTTAGGGAGTGGTGCTGGAGCCTGGAATTTTTATAGCAGGG
TAACTGATAGTTAGGTTTTGCCTGAACTCAGGTG
Sequence Type genomic DNA
Unitrap ID UNI17422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109121859..109122052 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066306 (Numa1) NM_133947 nuclear mitotic apparatus protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443665]


SPLK-Sequence tag 3SD136F11
Sequence
CAGATGCTGCAGCCATTTTCTTACCTGTGAGTCTCTAAACCTTTGGAACTTTGGAGTTGGAGCCTGGTGGGTTTGAGGAA
TGACACCTTGAGGTGGAAGCCTGTGGCCCTAACATTCTGGGAGTAGGAACAGTAAAAGAACGAGGGTCAGTGCTGGCAGG
GGCTCCTAAGTTGAGAACTTGAACAGGTCAGTAGCCAAGACCAAAGTTCACTTTGGTGTTATCTTGAGGTGAGGTGGTGG
TGTTCAGGCAGGTAGCCGTTAAGAAGGAGCTGAAGCCCAGACTAAGGGATGGCACATGGGAGGAAGGAGTTGGGCTGCCT
CACAGACCCTCTGGCATATCACCAAAAACCACAATTGTTTTCAGAAGAGACCTCCAGAGCTGAGCAACCTGACCCCTCTC
TGGTCTGGTTCTTGCATCTAGCAGGTGGTTTACATTAGTCTCAGCCCTTATAGGAAACTGTGGCTAGTCTTTAACTCCTT
CAG
Sequence Type genomic DNA
Unitrap ID UNI17422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109122055..109122537 481
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066306 (Numa1) NM_133947 nuclear mitotic apparatus protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443665]

 
Come back to gene ENSMUSG00000066306


For any suggestions or comments, please send an email to unitrap@crg.es