Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D062A02
Clone ID D062A02
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D062A02
Sequence
CACAAAATAAAAGGGCTGAAGGGTAGCAGACGTTTCCACAGCCGCCGACCCGCAGCTTGAGTGTCCTGCACCACCTTTCG
TGGAAATCTGAGCCGGCTGTACAG
Sequence Type mRNA
Unitrap ID UNI3739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106860673..106860776 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018362 (Kpna2) NM_010655 karyopherin (importin) alpha 2 Gene [Source:MGI (curated);Acc:Kpna2-001]

 
Come back to gene ENSMUSG00000018362


For any suggestions or comments, please send an email to unitrap@crg.es