Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D059H03
Clone ID D059H03
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D059H03
Sequence
AGCACCTCTCTTGGGGCTTCTCCGTCCTCGGCGCTTGGAAGTACGGATCTTTTTTCTCGGAGAAAAGTTCACTGGAACTG
GAAGAAATGGATTTATCTGCCGTCCAAATTCAAGAAGTACAAAATGTCCTTCATGCTATGCAGAAAATCTTAGAGTGTCC
GATCTG
Sequence Type mRNA
Unitrap ID UNI10449

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101410329..101413149 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]


SPLK-Sequence tag 5SD059H03
Sequence
AGCTTCGATGGATAAATGCAAGTAAATTTGCCTCTGTGCTTCACGGGGTTGTTATTTTGTTCAGAGTCAAGTTAATAAGG
TTTAGGTAGATGTGTGTGCTTCCAGAGACAAGATTTCAAAAGTGCTAGCCACTCTACAGCATTGCAGCTGAATAAAAACA
AGTCCTAATGAGATTTACAACCAAGTCTATGAAATATCAAAGCCACAGAGGCAGAAATAACACTGCGAGAGAAAGATGGG
CTGTGAGAAGCCTAAGTTTACTGAGGATAATTATAAACAGTGATCAAAA
Sequence Type genomic DNA
Unitrap ID UNI10449

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101407730..101408018 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]


SPLK-Sequence tag 3SD059H03
Sequence
TTCAGATACATACAAACTAAAGATGCAAGGGAGAAAGTTACTGCTAAATTTTCAGTTGTTCAATGTCCCTGGCTTCTTCG
TGCACTTCTTGTTCTCCTTGAGACAGGGTCTCAAAGGTCTCAGTCCTCCTATCTCAGCCTCGAAATGCTNNNATTATGGG
TGTGCATTTGCAAGCTTTAGGCTTGC
Sequence Type genomic DNA
Unitrap ID UNI10449

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101407197..101407382 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es