Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D135C10
Clone ID D135C10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD135C10
Sequence
TCCCCAGCATCTCCTGCAGCATCACTAAGCACCTGTGAACACCTACTCAATCAGGTCTCACCCCACGTTGCCTCAGATTT
GGCTGCGTAATTATGTGGGCCAGTAGAACACACTTAATTGGGAGTCATTGAGTCATAAGTCCTCTGAG
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84843452..84843598 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


SPLK-Sequence tag 3SD135C10
Sequence
TGAGCCCTCCTGCTACCGTGCAAGCTCTTGAGCTGGGGCCAGGCTCTTAATTTATCTGAGCCCCAGTTGCTTCATCAGCA
TACTAAGGTCACTAGACTTAGAAG
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84843595..84843698 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es