Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D135A09
Clone ID D135A09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD135A09
Sequence
AACCAACATGTAGCTCAGCGCCACCTTTGGGACCACTTCAGGGCCATACTAGATGCTGTTACAGACCTGTCTTGGGGTTC
CACTAATGCTTTGATGGGAGTGGCTCTTGGTTCTTGTCTTTAGTCCCA
Sequence Type genomic DNA
Unitrap ID UNI14894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150778035..150778162 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010755 (Cars) NM_013742 cysteinyl-tRNA synthetase Gene [Source:MGI (curated);Acc:Cars-002]


SPLK-Sequence tag 3SD135A09
Sequence
CCCATAGGTTACATTTGTTTCTCTTCAGATGCAATGTCACTAAATATTGG
Sequence Type genomic DNA
Unitrap ID UNI14894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150777989..150778038 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010755 (Cars) NM_013742 cysteinyl-tRNA synthetase Gene [Source:MGI (curated);Acc:Cars-002]

 
Come back to gene ENSMUSG00000010755


For any suggestions or comments, please send an email to unitrap@crg.es