Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D058H09
Clone ID D058H09
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D058H09
Sequence
AACAAAGAGANNNTTCCGAGTTTTAGAGAGTGTAGCGGTGCATAATCCAGAGAATCAAAGCTGCTTGATAGCCTATAAAG
ATTCACAACTCATTATTTCATCAGCTAA
Sequence Type mRNA
Unitrap ID UNI10450

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35544767..35546993 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]


SPLK-Sequence tag 5SD058H09
Sequence
GATCTCTGCTTTGAAAAACTAATCTTAAATTGCAATTCTATATGACCCTTGGCTGTCTTTGTAAATTTCCTTATACAAGA
ACAACTATTTTAGTGTGAATGGTCCGGTTTATTTGTGTATTAACCTTTTATTTGGAGAGTTTCAAATTAAGAGACATATA
GACTGAATAATGTGATAAACTCTTATACTTAGCTTGAATAATACATGGGTGATCCT
Sequence Type genomic DNA
Unitrap ID UNI10450

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35547702..35547917 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]


SPLK-Sequence tag 3SD058H09
Sequence
CTTATGCTTCTTAGTCTCTGAGAATTGCCTTAGTAAAGAAGTATTTAATGTGACATATTTCATCTCTTGCATGGGGTTTT
CTTGTGAAATGTTTGTAGAAGTGGTGATAAAAGTCAGAATTGGGTTTTGGGAAATAGCATTCACCTATAGCTTTCAAGAA
AACACTTATAGATACTTAGTAATATTTAGCACAGACAGTTTAGTTACTAATAGCAACAGGGAAATGTTGTCAACATCCTC
AAACATTAAAGAAGCAAATTTTTTAGGTTTGACAGTAAAAGAACATCTTTCTAACCAAGAACTGTAAAATATTAGGAACC
TTACAGGATTTCCTCATTGCATATTAAAAATAAGCTAGGAATAGATTAAATATGTAGAATTTTTCTTTACGGGTTTGATG
TGGTATGCAAT
Sequence Type genomic DNA
Unitrap ID UNI10450

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35548270..35548680 411
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es