Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D134E06
Clone ID D134E06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD134E06
Sequence
AAAGGAAACACAGAGACACATGTAAAAAGGCTGAGAGTTTCAAAGCATCACAGGACTTAGAAATTGAGCATGTGGGCCTT
TTAAATGCAGGTAATCAGTGGTTGTTCGTATTCAGAAGTTAAAAGCAGGCAGGTTTTCCCTGAGGTGTGGATTCCTGAGG
TTAGGTGGGCAGCCCTCTCTCCCCTGCTTTCAGTTCCTTGTGTGCATTGCTCCTTTGAATTGTGTGTTACTTCAGGGCTC
CTGTTAAACCAGGAAGATACCTCCAAAGTCACCTCTCTGTGACATTGTTGGCACTCCTCTGCCAGCCCTGACAGGCTGTT
TTAAAAGTGGACTCTACACTCTAACCTGCCTATAGTACCAGGGTCTCGGTCAGTTTTATTGCTTAGTACTCAAGAGTTTA
CAAATATAAAAGTGACATGACTGTACTCCATGGCTTCTTGCCAGGGAGCTGCTCATGGGCACTGATGCTATTAAGGTGAC
AGTGGCTCCCATGAGTCCAGTTCCCTCTTCTCTCAATTGTGGGT
Sequence Type genomic DNA
Unitrap ID UNI10483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75254034..75254557 524
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042688 (Mapk6) NP_081694 mitogen-activated protein kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1354946]


SPLK-Sequence tag 3SD134E06
Sequence
ATATCGAGCTTGGCTGCGAGAATTTGATGTCTGCTTTTTGTCTT
Sequence Type genomic DNA
Unitrap ID UNI10483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75253866..75253909 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042688 (Mapk6) NP_081694 mitogen-activated protein kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1354946]

 
Come back to gene ENSMUSG00000042688


For any suggestions or comments, please send an email to unitrap@crg.es