Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D058H03
Clone ID D058H03
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D058H03
Sequence
TTCATATTCTCCATTAAAGGCTCAGGCTTCTTTGCATTGTGTCTTTCGAAAACTCACAGAGAACAGTGAAGAAAGTTCAG
CATCCTGCAGTCGATCTTATAGGCGACAAGAAAACAGGAAGCCTTCAGATAAAAAAACATTGGAAACCTGGANTTACAAC
GCCAACCAGCACTCTACAGGAGGTAGAAGAGAACAGTTACAGGCTGAGAGCATGAGTTGTGATCCACCAGGAAGAGGACT
TCAGCAAGACATGACATTGACAATCGCTGG
Sequence Type mRNA
Unitrap ID UNI10451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3430818..3431087 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025898 (Cwf19l2) NM_027545 CWF19-like 2, cell cycle control (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1918023]

 
Come back to gene ENSMUSG00000025898


For any suggestions or comments, please send an email to unitrap@crg.es