Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D134C10
Clone ID D134C10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD134C10
Sequence
TCTCCGAATCCAGATGATGCAAGAGACCATTGCACAAACTCAGCAGTGTTAGTCATGTGATTGCCAGCGACATCCCTTTG
CTGCTTCAGTACATGGGTTCAGAACTACTTTCACAATACGATACTGAGCTTACAAGAATACCAGGGAAAGTAATATTTAT
TAAAAAGCCAACTTCCGTAATGTGTGCGCTGTGTACTATACTCACTCAGTCCTTGCAGCAGCCTGCGTCCTATTGCGGGG
TCCTGTCTCTTGGGAGTTGTAAATCTTAGGCATCAGCCACTGCAATGTACAATTATTACTGGCTTTTCTAATTAATGTCA
CCCACGCTTCTGTCTCCACATGTAGAAGGAGATGAGGTGTTCATATTTGAAACAGTGCTCCCCGTGTAAAATCAAGCCCG
CCCAGGCTGGAGAGCTGGCTCAGGGTAGGGACACTTGG
Sequence Type genomic DNA
Unitrap ID UNI22700

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91727449..91727886 432
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058240 (Cryzl1) NM_133679 crystallin, zeta (quinone reductase)-like 1 Gene [Source:MGI (curated);Acc:Cryzl1-003]

 
Come back to gene ENSMUSG00000058240


For any suggestions or comments, please send an email to unitrap@crg.es