Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D058E05
Clone ID D058E05
Vector rFROSAbgeo+1s
Project ggtc

Sequence tag D058E05
Sequence
GGGCATCTCAGAGACCACAATCCTGCAGAGTGGCATGAGACTGCAGTTTGGCCCCTCGCATGTGTTTAAGTTTGTGGGCC
CCATCCAGGACCACGTTCTTTCCAAGAGATCTGTGGATGGAGGCCTGATGGTCAAGGGCCCAAGACATAAACCTGGAGCT
GTTCAGGAGACAACCTTTGAATTGGGAGGAGATGTCCACAGTGGGACAGCATTGCCGGCAAGCAGGAGCACTACTAGACT
GGACAGTGACAGGGTGTCCTCTGCCTCTAGCACAGCTGAGCGAGGGATGGTGAAGCCGATGATCCGACTGGACCAGGAGC
AGGAATATCGACGACGAGAAAACAG
Sequence Type mRNA
Unitrap ID UNI10434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13966986..13972363 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068036 (Mllt4) NP_034936 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene [Source:MGI Symbol;Acc:MGI:1314653]


SPLK-Sequence tag 3SD058E05
Sequence
TTTTATAATTATTCCTAATTATCTCTGTAAAGTTGGACAAAAGTGAAAAAGATGTTGAAATATTAACGAAGGTTACTTGT
CTTTTTATTTAGTAGCAAACTACCTTAGAATAACTATGGTCGTAATTACATCTCAAAAGGAAAGGGTATTTGAGGGGAAT
GTTAGCCATTAAGGTAAGGAGAGCTACAGTGGAGTTATACTTATGTAGTTTACTATTTCTGCCAGACCTCAGAGGGAACT
TTCAAATGTTTTCTGGCCATAGTCATAGCCTGTAGAATATCGGGCCTGTTGGATGTACTCAGGCATGTGTACAGGTTTAC
AGCTGAGGAGGAGTTAGGCAGAACAGTGTTCAGGCATCTTTCCTCAGCACTGGGGCTCTGAGCCATCTTCTGAAGACATC
TATCGCAGAACTAGACTTAGCCTTCTAATTCATTTGTTCCTGAGTACCTAGAGACGTATAAACAGTAGCACAGTAAGTAC
TTAGCTAGTTCTTAGAAATGTTTCCAGTTATTTAAATTTTTGATAATTCCTTATAGGTAAAGTGATAGCATCTGATATTT
ATGTGACCTTGAGGAAGATGAGCAGATAGAATGACCATTTT
Sequence Type genomic DNA
Unitrap ID UNI10434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13982112..13982712 581
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068036 (Mllt4) NP_034936 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene [Source:MGI Symbol;Acc:MGI:1314653]

 
Come back to gene ENSMUSG00000068036


For any suggestions or comments, please send an email to unitrap@crg.es