Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D133H03
Clone ID D133H03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD133H03
Sequence
GTACATATTAGAACCCTGGTGTACCTATATGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD133H03
Sequence
CAATGTAATTGTTTAAAAATTATTTATTCTTTCTCAATTTCATTCATGTGTGTAATGTACTTTGAAACACCCACATTAAC
CTCTGTCATTTATCTTTGTAATGTGTATATTTGCACAAACATATATCTCATATATGTAAGTGCATGCGTACACGTGCTAT
GATTTTGCATCTGTAAGAATGAAACACCAGTATACCCTTTTACTTCAGCCTACTTTACACTGCTGTGAAAAACAATGTTA
TACAAAAGCTTTGGCCAATTTCTCCCCTTAAAAGGAATTTCAAGTCTATCCAAGCTTCTGTGCTAGTGACTACNNNGAAC
CAAAGCTTTCTGTCACATGGCCTAGGATCC
Sequence Type genomic DNA
Unitrap ID UNI683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53948608..53948957 342
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es