Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D133F08
Clone ID D133F08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD133F08
Sequence
GATCCCCAGGTTGTGTTTGCTGTGGTGCTCAGGAGGGTGCCTGAAAGTCTATCTTGTCCCCACAGGAG
Sequence Type genomic DNA
Unitrap ID UNI25297

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51826523..51826590 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021451 (Sema4d) NM_013660 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D Gene [Source:MGI (curated);Acc:Sema4d-001]


SPLK-Sequence tag 3SD133F08
Sequence
GGAGCACCTAATGGTACCCTCTTTGTGATCTATTCCCGTTATTAGATCCCA
Sequence Type genomic DNA
Unitrap ID UNI25297

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51826476..51826526 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021451 (Sema4d) NM_013660 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D Gene [Source:MGI (curated);Acc:Sema4d-001]

 
Come back to gene ENSMUSG00000021451


For any suggestions or comments, please send an email to unitrap@crg.es