Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D133B04
Clone ID D133B04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD133B04
Sequence
ACAGCCGCTGTGAGCCTGTGTGAGCAACAGCCACGCCTCATCCAGGGGATGGCTCTCCACAGCTGCTCTTCTGCGGCCCT
CCATGTTTTTAAGTAATCATATCTGAGAACACAGCATGGGGAAAAAAGTCCCATGAACTTTAACTTCCTAAGGCGGGATA
ACAAATTTATCTTGCGATAAACATGAAGGGACCGGATTGTTCACTGTCAGGTTGTTGCTCACAGCAGACAGGGCATTGGC
TTCAGCCTGATGTGTGATGTTTTCTGACATTTCCCACAGATATTGATCCCAGAAATGGAATCCCCAAATTGACACCAGGG
GATAATCCGTACATGTTCCCAGAACAGAGTAAAGAGTTCTTCAAAGCGGGAGCAACTTTGCCTCCGGTGAACTTCTCACT
GTGAGTCCATGCTCATTCCCCAGTTTTATTAACCGTCTCTGCTGAGTGTAAATTAACAGTACTTAGGTATTTTGTTACGT
ATCTTGGTGTGTCTGTGTGTGTTAAAAGCACCTATTTATGCAGGAGTGTATACTCACACACGTGTATGTGGAGGCCACAG
GAGGATACACAGTGTTTTTCTCTATTGCTTTCTG
Sequence Type genomic DNA
Unitrap ID UNI30065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45590846..45591439 594
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


SPLK-Sequence tag 3SD133B04
Sequence
CTGCACTTATGTTTTTAGACTGGATTTCTCTGAACCTAGAGCTTGACATTTTGACCAGGTCAGTTGGCCTGTGAGTATCT
AGG
Sequence Type genomic DNA
Unitrap ID UNI30065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45590766..45590848 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es