Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D131F04
Clone ID D131F04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD131F04
Sequence
GATCTTGAATTAAAATTAATAAAGAAAAGAAGAAACCAAGCTAATAAATGTTGGCTGGGTTTCCTCTCTTGACTCTGAGA
GTGAGTCTGCTGCCCCTTGGAACACCGGTCTGTTGAGCAATTCCCACCAGCCCCTCGGTTTCAGTGTCAGGTTAAAGGTC
ACAGAATTTTTGTTAAGATCAAGATGCTTCATTCTCATTAAAATTTTAGAATAATCAGTAAAATGACTCATCTCTAGACA
ATTGTGTAGCTGTCAGTCTCTTTTGGAAGTAAATTAAAGGACTTCCAGCTCTCATGACTCAGACAGGTAGTGTGGGGGCC
AGTGGCCCTTGCTTGGCCAGTGCTGCTGGATGCTAGGTTAGGCTACCCTGCTAACATTCCGCTGTCTGCCTTCTGGACT
Sequence Type genomic DNA
Unitrap ID UNI1312

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149319643..149320041 393
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001687 (Ubl3) NM_011908 ubiquitin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1344373]

 
Come back to gene ENSMUSG00000001687


For any suggestions or comments, please send an email to unitrap@crg.es