Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D131B03
Clone ID D131B03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD131B03
Sequence
AATGCAACATAGCAGTATGTATNNGTTACNNCGTTAGTTTTAGAAACAACCATTTCTGTGAGCCTTTGGGAAACTGTTAA
GTTGGGATTTTGAGTTCAGTCAAATGAAGGGGGAATCTCTTGTTCCTGGAGCTGGGAGAAGTGACATGCTCCTGTCTTTG
AGGCTACTTACGATGCTCCACTGTACTGGTTACAGTGAGGCTAG
Sequence Type genomic DNA
Unitrap ID UNI27250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81034750..81034949 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]

 
Come back to gene ENSMUSG00000031684


For any suggestions or comments, please send an email to unitrap@crg.es