Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D130B09
Clone ID D130B09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD130B09
Sequence
GTCATGGCAACATTTTTAGCAACTGTGTTGCTCTACAGGAAGCCTTGCTGAATAAAATAAAGAAGCCTTGAACATGATGC
ACTTGGGCACTGGTGTTTGTAACAGATGCTGTAAATCTGGACTCTCTCAAAACAAGAGCCCCGACAGCGGAGTAGTATCC
AAGAGCCAAACCTGGGTTTTATGCTTAGTGATGGTTTCCCAATAGCAAAAAAGGTTTCAGTTTTCCTCTTCTTAGATTTG
AGGACTGGAATTTGTTTTTTGTTAT
Sequence Type genomic DNA
Unitrap ID UNI6767

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173342817..173343080 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026641 (Usf1) NP_033506 upstream transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:99542]

 
Come back to gene ENSMUSG00000026641


For any suggestions or comments, please send an email to unitrap@crg.es