Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D129F10
Clone ID D129F10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD129F10
Sequence
TCCCTTGGCTAGATGTGGGCCTAAGGGGCTTAGCTTTGTTTTTGCTTTTTAATAGTGTAGTGCTAAGGCTCTGGAAAGGT
TGTTGGACACCTTAGGTATCTCTGAGCTTCATTTCCCAGTCCTTTGTAAGG
Sequence Type genomic DNA
Unitrap ID UNI672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 143752300..143752430 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015932 (Dstn) NM_019771 destrin Gene [Source:MGI (curated);Acc:Dstn-001]

 
Come back to gene ENSMUSG00000015932


For any suggestions or comments, please send an email to unitrap@crg.es