Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D129A06
Clone ID D129A06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD129A06
Sequence
AACTCACTAGTGCTGACAGACGTCTCATCTGGCCANNAGAGAGAAAACGCTGACCGAAGTCACCAGTGGCTTCCCAGTAG
CCAAATCAGAAGACATTTTAAAATTTTTCAGCCGACCTAATTGTTTGAGCTTGTTGGCTTCTTTCTGCTAACACTCCTCT
CTTGCTAGTGTTCTGTGTTTCATGTTGACAACTTTTTCCTTATTTTACCGGCAAACCCCATAGATTTTTTTGTCGAGCCA
AGGCCCTCTGCAGACTAGTTTATAGCCCT
Sequence Type genomic DNA
Unitrap ID UNI2899

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75161114..75161381 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000751 (Rpa1) NM_026653 replication protein A1 Gene [Source:MGI (curated);Acc:Rpa1-001]

 
Come back to gene ENSMUSG00000000751


For any suggestions or comments, please send an email to unitrap@crg.es