Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D128H11
Clone ID D128H11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD128H11
Sequence
GTTACACCATACTGTCCATTGTCCCAGAACATAAGATGTTTTAAATGTTATCAGTGATGCTGATAGATACCAAGCTCCCA
TGACCTTTGCTTAGGGCATTTGCCAGGTACTGCAATTTCAGGTTTGCAGGGTTGGGTTTTAACAGGCATGGCTACGAGAC
TTGCTCTACTTCCTCCTTCGGTGCTGGTGGCTCTGGGCTCCTGTTCCAGC
Sequence Type genomic DNA
Unitrap ID UNI2866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 119490425..119490634 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025583 (4932417H02Rik) NM_028898 RIKEN cDNA 4932417H02 gene Gene [Source:MGI Symbol;Acc:MGI:1921620]

 
Come back to gene ENSMUSG00000025583


For any suggestions or comments, please send an email to unitrap@crg.es