Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D128H01
Clone ID D128H01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD128H01
Sequence
GAACATGGGCTCTTTAAAGAACTAGAGCCCCCGCCGTTTGGCCTTCTCAAAAATTCCTTAAAGCGAGATGGAGACTTTGC
AAAACTTTGGGACAGAGGCTCGTGGCCCGAGCTCTTAA
Sequence Type genomic DNA
Unitrap ID UNI30070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123060704..123060821 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es