Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D128F05
Clone ID D128F05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD128F05
Sequence
GATCCTGTCTGTCTCACCTTCTACTAAGAAGGCCTTGGCCTTGGGGCTGTGCCAAGGTCAAGGGTTCATGAGCTGGACGA
TCCTTTAGAGGAGGACACCCTCGGCCGCTGCTGTTTCGAGAAAGGATGAAAGGTGTAGGTTGACCTGAGAAATGGGAGCA
CAAAAGACGAGGGGTCTGGGCGCTTCATTCTGCTTTCAGAACACAGCCCATGTGGCTGTCCAAGTATGTGTAGCTGAGAC
TGTTTTCTTATTAAACGTCTCCCCTTTCTAACCCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121244945..121245223 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es