Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D127G03
Clone ID D127G03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD127G03
Sequence
TGATGAGGTTATCATATCTTCTGTTTTATTTGTTTACTATTACTCTGATGTGTTCATGTATGATGCATGTGTGTGATGNN
AAAGCACATGTGCCATGCGTGGCGTGAGCATGGAAACTGAGGACAGCATTGAGGAGCCCCCACCTAGGTTCTGAGGACTG
AAATAAGGGAGTCAGGATTGCTGGGCCAGGGNNTTGCTGATTGACTCAGTCTTTCCATTGTTCTCTTCTTACTTTCATTT
AATCCTTTACATCTTTCTTGAACTTAAGCTTTTAAATTATCT
Sequence Type genomic DNA
Unitrap ID UNI14267

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62250065..62250347 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


SPLK-Sequence tag 3SD127G03
Sequence
AATTTGTGACCCATCTTAAGCAGCTTGTAAGCTCTGAATTTCTATTATCTGCTTATAGAGAAGGGTCTTCCTAGTTGAGC
CTTAGTTCAGTTTTGACATGATTATGACTCTCAGAACTTCTTCTGTATGTAGAGTTCACATAACATAAAACTTAATATTC
TGAAGCTTGTGTTATATGTGCGCCAAGAACA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es